Review



human renal proximal tubular epithelial cell line hk  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC human renal proximal tubular epithelial cell line hk
    Human Renal Proximal Tubular Epithelial Cell Line Hk, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 4587 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/renal+tubular+epithelial+cell+line+hk+2/HK-2/pm42802968-57-1-12
    Average 99 stars, based on 4587 article reviews
    human renal proximal tubular epithelial cell line hk - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Cell Culture:

    Article Title: PDCD4-induced oxidative stress through FGR/NF-κB axis in rectal cancer radiotherapy-induced AKI.
    Article Snippet: This study aimed to investigate the molecular mechanism of the effect of PDCD4 on radiotherapy-induced acute kidney injury (AKI) in rectal cancer through the regulation of FGR/NF-κB signaling.. Differentially expressed genes were identified using Gene Expression Omnibus (GEO) datasets (GSE90627 for rectal cancer and GSE145085 for AKI) and R software.. The human renal tubular epithelial cell line, HK-2, was used to establish an in vitro model of radiotherapy-induced AKI.

    Article Title: Reappraisal of profibrotic phenotype and cell-cycle state of renal tubular epithelium after ischemia–reperfusion injury
    Article Snippet: Polymerase chain reaction (PCR) genotyping was performed using KOD One PCR Master Mix (KMM-201; Toyobo, Osaka, Japan) with PCR primers and annealing temperature as follows: R26_WTF(RM), CAAAGTCGCTCTGAGTTGTTATC; R26_WTR(RM), GGAGCGGGAGAAATGGATATGAA; and F2AR(RM), TGGCGGCCGCTCGAGATGAATC, 60°C [ ]. .. The cultured human renal tubular epithelial cell line HK-2 (ATCC Catalog Number: CRL-2190) was cultured in the Ham’s F-12 and Dulbecco’s Modified Eagle Medium (4.5 g/L glucose) (Nacalai Tesque, Kyoto, Japan) supplemented with 5% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin in a humidified atmosphere at 37°C with 5% CO 2 . ..

    Article Title: Gastrodin alleviates cisplatin nephrotoxicity by inhibiting ferroptosis via the SIRT1/FOXO3A/GPX4 signaling pathway.
    Article Snippet: For the in vitro experiments, GAS was obtained from Herbest (Purity: 98%) (Cat: 62499-27-8), and CP was obtained from MCE (Purity: 99.7%) (Cat: HY-17394). .. The immortalized human renal tubular epithelial cell line (HK-2) (ATCC) was cultured in Dulbecco’s modified Eagle’s medium and Ham’s F-12 medium (Gibco, China) supplemented with 10% fetal bovine serum (Cat: 10100) (Gibco), and 100 U/mL streptomycin and penicillin (Cat: 15140122) (Thermo Fisher Scientific, USA). .. C57BL/6 male mice at ~10 weeks of age, weighing 20–23 g, were purchased from Huafukang Biology Technology Co. Ltd (Beijing, China).

    Modification:

    Article Title: Reappraisal of profibrotic phenotype and cell-cycle state of renal tubular epithelium after ischemia–reperfusion injury
    Article Snippet: Polymerase chain reaction (PCR) genotyping was performed using KOD One PCR Master Mix (KMM-201; Toyobo, Osaka, Japan) with PCR primers and annealing temperature as follows: R26_WTF(RM), CAAAGTCGCTCTGAGTTGTTATC; R26_WTR(RM), GGAGCGGGAGAAATGGATATGAA; and F2AR(RM), TGGCGGCCGCTCGAGATGAATC, 60°C [ ]. .. The cultured human renal tubular epithelial cell line HK-2 (ATCC Catalog Number: CRL-2190) was cultured in the Ham’s F-12 and Dulbecco’s Modified Eagle Medium (4.5 g/L glucose) (Nacalai Tesque, Kyoto, Japan) supplemented with 5% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin in a humidified atmosphere at 37°C with 5% CO 2 . ..

    Article Title: Gastrodin alleviates cisplatin nephrotoxicity by inhibiting ferroptosis via the SIRT1/FOXO3A/GPX4 signaling pathway.
    Article Snippet: For the in vitro experiments, GAS was obtained from Herbest (Purity: 98%) (Cat: 62499-27-8), and CP was obtained from MCE (Purity: 99.7%) (Cat: HY-17394). .. The immortalized human renal tubular epithelial cell line (HK-2) (ATCC) was cultured in Dulbecco’s modified Eagle’s medium and Ham’s F-12 medium (Gibco, China) supplemented with 10% fetal bovine serum (Cat: 10100) (Gibco), and 100 U/mL streptomycin and penicillin (Cat: 15140122) (Thermo Fisher Scientific, USA). .. C57BL/6 male mice at ~10 weeks of age, weighing 20–23 g, were purchased from Huafukang Biology Technology Co. Ltd (Beijing, China).



    Similar Products

    human renal proximal tubular epithelial cell line hk  (ATCC)
    99
    ATCC human renal proximal tubular epithelial cell line hk
    Human Renal Proximal Tubular Epithelial Cell Line Hk, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/renal+tubular+epithelial+cell+line+hk+2/HK-2/pm42802968-57-1-12
    Average 99 stars, based on 1 article reviews
    human renal proximal tubular epithelial cell line hk - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    human renal tubular epithelial cell line hk2  (ATCC)
    99
    ATCC human renal tubular epithelial cell line hk2
    Human Renal Tubular Epithelial Cell Line Hk2, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/renal+tubular+epithelial+cell+line+hk+2/HK-2/pm41678739-58-1-10
    Average 99 stars, based on 1 article reviews
    human renal tubular epithelial cell line hk2 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    human proximal renal tubular epithelial cell line  (ATCC)
    99
    ATCC human proximal renal tubular epithelial cell line
    Human Proximal Renal Tubular Epithelial Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/renal+tubular+epithelial+cell+line+hk+2/HK-2/pm42262012-93-0-11
    Average 99 stars, based on 1 article reviews
    human proximal renal tubular epithelial cell line - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    renal proximal tubular epithelial cell line  (ATCC)
    99
    ATCC renal proximal tubular epithelial cell line
    Renal Proximal Tubular Epithelial Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/renal+tubular+epithelial+cell+line+hk+2/HK-2/pm42191095-46-2-13
    Average 99 stars, based on 1 article reviews
    renal proximal tubular epithelial cell line - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    transfection wild type human renal tubular epithelial cell line hk 2  (ATCC)
    99
    ATCC transfection wild type human renal tubular epithelial cell line hk 2
    Transfection Wild Type Human Renal Tubular Epithelial Cell Line Hk 2, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/renal+tubular+epithelial+cell+line+hk+2/HK-2/pm42174657-54-3-12
    Average 99 stars, based on 1 article reviews
    transfection wild type human renal tubular epithelial cell line hk 2 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    renal tubular epithelial cell line hk 2  (ATCC)
    99
    ATCC renal tubular epithelial cell line hk 2
    The effects of NTN1 on the apoptosis, inflammatory levels and ROS generation in <t>LPS-treated</t> <t>HK-2</t> cells (A–B) after the transfection of NTN1 overexpression plasmid or si-NTN1, the expression of NTN1 in the blank, OE-NC, OE-NTN1, si-NC, and si-NTN1 groups was determined by qRT-PCR. GAPDH served as the internal control. (C–D) the apoptosis rate of HK-2 cells or RPTEC/TERT1 in the OE-NC, OE-NTN1, si-NC, and si-NTN1 groups was assessed by flow cytometry. (E–G) the levels of TNF-α, IL-6 and IL-1β in the OE-NC, OE-NTN1, si-NC, and si-NTN1 groups were determined by ELISA. (H) The level of ROS generation in each group was detected by DCFH-DA reagent. The data are presented as the mean±standard deviation of three independent experiments; *** p<0.001 vs. OE-NC; ### p<0.001 vs. si-NC. Abbreviation: NTN1, netrin 1; ROS, reactive oxygen species; LPS, lipopolysaccharides; OE-NTN1, NTN1 overexpression; si-NTN1, silenced NTN1; NC, negative control; qRT-PCR, quantitative real-time PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; ELISA, enzyme-linked immunosorbent assay; DCFH-DA, 2,7-Dichlorodi-hydrofluorescein diacetate.
    Renal Tubular Epithelial Cell Line Hk 2, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/renal+tubular+epithelial+cell+line+hk+2/HK-2/pmc13182857-33-0-13
    Average 99 stars, based on 1 article reviews
    renal tubular epithelial cell line hk 2 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    renal tubular epithelial cell line hk  (ATCC)
    99
    ATCC renal tubular epithelial cell line hk
    The effects of NTN1 on the apoptosis, inflammatory levels and ROS generation in <t>LPS-treated</t> <t>HK-2</t> cells (A–B) after the transfection of NTN1 overexpression plasmid or si-NTN1, the expression of NTN1 in the blank, OE-NC, OE-NTN1, si-NC, and si-NTN1 groups was determined by qRT-PCR. GAPDH served as the internal control. (C–D) the apoptosis rate of HK-2 cells or RPTEC/TERT1 in the OE-NC, OE-NTN1, si-NC, and si-NTN1 groups was assessed by flow cytometry. (E–G) the levels of TNF-α, IL-6 and IL-1β in the OE-NC, OE-NTN1, si-NC, and si-NTN1 groups were determined by ELISA. (H) The level of ROS generation in each group was detected by DCFH-DA reagent. The data are presented as the mean±standard deviation of three independent experiments; *** p<0.001 vs. OE-NC; ### p<0.001 vs. si-NC. Abbreviation: NTN1, netrin 1; ROS, reactive oxygen species; LPS, lipopolysaccharides; OE-NTN1, NTN1 overexpression; si-NTN1, silenced NTN1; NC, negative control; qRT-PCR, quantitative real-time PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; ELISA, enzyme-linked immunosorbent assay; DCFH-DA, 2,7-Dichlorodi-hydrofluorescein diacetate.
    Renal Tubular Epithelial Cell Line Hk, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/renal+tubular+epithelial+cell+line+hk+2/HK-2/pm42154117-44-15-24
    Average 99 stars, based on 1 article reviews
    renal tubular epithelial cell line hk - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    The effects of NTN1 on the apoptosis, inflammatory levels and ROS generation in LPS-treated HK-2 cells (A–B) after the transfection of NTN1 overexpression plasmid or si-NTN1, the expression of NTN1 in the blank, OE-NC, OE-NTN1, si-NC, and si-NTN1 groups was determined by qRT-PCR. GAPDH served as the internal control. (C–D) the apoptosis rate of HK-2 cells or RPTEC/TERT1 in the OE-NC, OE-NTN1, si-NC, and si-NTN1 groups was assessed by flow cytometry. (E–G) the levels of TNF-α, IL-6 and IL-1β in the OE-NC, OE-NTN1, si-NC, and si-NTN1 groups were determined by ELISA. (H) The level of ROS generation in each group was detected by DCFH-DA reagent. The data are presented as the mean±standard deviation of three independent experiments; *** p<0.001 vs. OE-NC; ### p<0.001 vs. si-NC. Abbreviation: NTN1, netrin 1; ROS, reactive oxygen species; LPS, lipopolysaccharides; OE-NTN1, NTN1 overexpression; si-NTN1, silenced NTN1; NC, negative control; qRT-PCR, quantitative real-time PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; ELISA, enzyme-linked immunosorbent assay; DCFH-DA, 2,7-Dichlorodi-hydrofluorescein diacetate.

    Journal: Open Medicine

    Article Title: NTN1 regulates autophagy through the MAP1B/DAPK1 axis to ameliorate acute kidney injury in vitro

    doi: 10.1515/med-2025-1374

    Figure Lengend Snippet: The effects of NTN1 on the apoptosis, inflammatory levels and ROS generation in LPS-treated HK-2 cells (A–B) after the transfection of NTN1 overexpression plasmid or si-NTN1, the expression of NTN1 in the blank, OE-NC, OE-NTN1, si-NC, and si-NTN1 groups was determined by qRT-PCR. GAPDH served as the internal control. (C–D) the apoptosis rate of HK-2 cells or RPTEC/TERT1 in the OE-NC, OE-NTN1, si-NC, and si-NTN1 groups was assessed by flow cytometry. (E–G) the levels of TNF-α, IL-6 and IL-1β in the OE-NC, OE-NTN1, si-NC, and si-NTN1 groups were determined by ELISA. (H) The level of ROS generation in each group was detected by DCFH-DA reagent. The data are presented as the mean±standard deviation of three independent experiments; *** p<0.001 vs. OE-NC; ### p<0.001 vs. si-NC. Abbreviation: NTN1, netrin 1; ROS, reactive oxygen species; LPS, lipopolysaccharides; OE-NTN1, NTN1 overexpression; si-NTN1, silenced NTN1; NC, negative control; qRT-PCR, quantitative real-time PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; ELISA, enzyme-linked immunosorbent assay; DCFH-DA, 2,7-Dichlorodi-hydrofluorescein diacetate.

    Article Snippet: Renal tubular epithelial cell line HK-2 (AW-CELLS-H0142, Anweisci, China), and RPTEC/TERT1 cells (CRL-4031, ATCC, Virginia, MA, USA) were placed in Minimum Essential Medium (MEM, BC-M-019, Sbjbio, China) enriched with 10 % fetal bovine serum (FBS, FCS500, ExCell, China) at 37 °C with 5 % CO 2 .

    Techniques: Transfection, Over Expression, Plasmid Preparation, Expressing, Quantitative RT-PCR, Control, Flow Cytometry, Enzyme-linked Immunosorbent Assay, Standard Deviation, Negative Control, Real-time Polymerase Chain Reaction

    The effects of MAP1B phosphorylation inhibitor on the apoptosis and autophagy in LPS-treated HK-2 cells (A) after the treatment of MAP1B phosphorylation inhibitor, the apoptosis of HK-2 cells in the OE-NC, OE-NTN1 and OE-NTN1+inhibitor groups was evaluated by flow cytometry. (B) The protein expression of Atg5 and the ratio of LC3II/LC3I were determined by western blot. GAPDH served as the internal control. The data are presented as the mean ± standard deviation of three independent experiments; *** p<0.001 vs. OE-NC; &&& p<0.001 vs. OE-NTN1. Abbreviation: MAP1B, microtubule associated protein 1B; LPS, lipopolysaccharides; NTN1, netrin 1; OE-NTN1, NTN1 overexpression; NC, negative control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

    Journal: Open Medicine

    Article Title: NTN1 regulates autophagy through the MAP1B/DAPK1 axis to ameliorate acute kidney injury in vitro

    doi: 10.1515/med-2025-1374

    Figure Lengend Snippet: The effects of MAP1B phosphorylation inhibitor on the apoptosis and autophagy in LPS-treated HK-2 cells (A) after the treatment of MAP1B phosphorylation inhibitor, the apoptosis of HK-2 cells in the OE-NC, OE-NTN1 and OE-NTN1+inhibitor groups was evaluated by flow cytometry. (B) The protein expression of Atg5 and the ratio of LC3II/LC3I were determined by western blot. GAPDH served as the internal control. The data are presented as the mean ± standard deviation of three independent experiments; *** p<0.001 vs. OE-NC; &&& p<0.001 vs. OE-NTN1. Abbreviation: MAP1B, microtubule associated protein 1B; LPS, lipopolysaccharides; NTN1, netrin 1; OE-NTN1, NTN1 overexpression; NC, negative control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

    Article Snippet: Renal tubular epithelial cell line HK-2 (AW-CELLS-H0142, Anweisci, China), and RPTEC/TERT1 cells (CRL-4031, ATCC, Virginia, MA, USA) were placed in Minimum Essential Medium (MEM, BC-M-019, Sbjbio, China) enriched with 10 % fetal bovine serum (FBS, FCS500, ExCell, China) at 37 °C with 5 % CO 2 .

    Techniques: Phospho-proteomics, Flow Cytometry, Expressing, Western Blot, Control, Standard Deviation, Over Expression, Negative Control

    The effects of MAP1B and DAPK1 on the apoptosis and ROS generation of LPS-treated HK-2 cells (A) Co-IP assay was performed to detect the relationship between MAP1B and DAPK1. (B–C) after the transfection of si-DAPK1 (B) or OE-MAP1B (C), the mRNA expression of DAPK1 or MAP1B in HK-2 cells was tested by qRT-PCR. GAPDH served as the internal control. (D) flow cytometry was used to determine the apoptosis rate of LPS-treated HK-2 cells in the si-NC+OE-NC, si-DAPK1+OE-NC, si-NC+OE-MAP1B and si-DAPK1+OE-MAP1B groups. (E) the ROS generation in each group was detected by DCFH-DA reagent. The data are presented as the mean±standard deviation of three independent experiments; ### p<0.001 vs. si-NC; +++ p<0.001 vs. OE-NC; *** p<0.001 vs. si-NC+OE-NC; ˆˆˆ p<0.001 vs. si-DAPK1+OE-NC; &&& p<0.001 vs. si-NC+OE-MAP1B. Abbreviation: MAP1B, microtubule associated protein 1B; DAPK1, death associated protein kinase 1; ROS, reactive oxygen species; LPS, lipopolysaccharides; si-DAPK1, silenced DAPK1; NC, negative control; qRT-PCR, quantitative real-time PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DCFH-DA, 2,7-Dichlorodi-hydrofluorescein diacetate.

    Journal: Open Medicine

    Article Title: NTN1 regulates autophagy through the MAP1B/DAPK1 axis to ameliorate acute kidney injury in vitro

    doi: 10.1515/med-2025-1374

    Figure Lengend Snippet: The effects of MAP1B and DAPK1 on the apoptosis and ROS generation of LPS-treated HK-2 cells (A) Co-IP assay was performed to detect the relationship between MAP1B and DAPK1. (B–C) after the transfection of si-DAPK1 (B) or OE-MAP1B (C), the mRNA expression of DAPK1 or MAP1B in HK-2 cells was tested by qRT-PCR. GAPDH served as the internal control. (D) flow cytometry was used to determine the apoptosis rate of LPS-treated HK-2 cells in the si-NC+OE-NC, si-DAPK1+OE-NC, si-NC+OE-MAP1B and si-DAPK1+OE-MAP1B groups. (E) the ROS generation in each group was detected by DCFH-DA reagent. The data are presented as the mean±standard deviation of three independent experiments; ### p<0.001 vs. si-NC; +++ p<0.001 vs. OE-NC; *** p<0.001 vs. si-NC+OE-NC; ˆˆˆ p<0.001 vs. si-DAPK1+OE-NC; &&& p<0.001 vs. si-NC+OE-MAP1B. Abbreviation: MAP1B, microtubule associated protein 1B; DAPK1, death associated protein kinase 1; ROS, reactive oxygen species; LPS, lipopolysaccharides; si-DAPK1, silenced DAPK1; NC, negative control; qRT-PCR, quantitative real-time PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DCFH-DA, 2,7-Dichlorodi-hydrofluorescein diacetate.

    Article Snippet: Renal tubular epithelial cell line HK-2 (AW-CELLS-H0142, Anweisci, China), and RPTEC/TERT1 cells (CRL-4031, ATCC, Virginia, MA, USA) were placed in Minimum Essential Medium (MEM, BC-M-019, Sbjbio, China) enriched with 10 % fetal bovine serum (FBS, FCS500, ExCell, China) at 37 °C with 5 % CO 2 .

    Techniques: Co-Immunoprecipitation Assay, Transfection, Expressing, Quantitative RT-PCR, Control, Flow Cytometry, Standard Deviation, Negative Control, Real-time Polymerase Chain Reaction

    The effects of MAP1B and DAPK1 on the membrane blebbing and autophagy of LPS-treated HK-2 cells (A) the membrane blebbing of LPS-treated HK-2 cells in the si-NC+OE-NC, si-DAPK1+OE-NC, si-NC+OE-MAP1B and si-DAPK1+OE-MAP1B groups was observed under the microscope (magnification × 400, scale bar=100 μm). (B) The protein expression of Atg5 and the ratio of LC3II/LC3I in each group were determined by western blot. GAPDH served as the internal control. The data are presented as the mean±standard deviation of three independent experiments; ** p<0.01, *** p<0.001 vs. si-NC+OE-NC; ˆˆ p<0.01, ˆˆˆ p<0.001 vs. si-DAPK1+OE-NC; &&& p<0.001 vs. si-NC+OE-MAP1B; ++ p<0.01, +++ p<0.001 vs si-NC+OE-NC+BafA1; ΔΔ p <0.01, ΔΔΔ p <0.001 vs. si-DAPK1+OE-NC+BafA1; ### p<0.001 vs. si-NC+OE-MAP1B+BafA1; $$$ p<0.001vs. si-DAPK1+OE-MAP1B. Abbreviation: MAP1B, microtubule associated protein 1B; DAPK1, death associated protein kinase 1; LPS, lipopolysaccharides; si-DAPK1, silenced DAPK1; NC, negative control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

    Journal: Open Medicine

    Article Title: NTN1 regulates autophagy through the MAP1B/DAPK1 axis to ameliorate acute kidney injury in vitro

    doi: 10.1515/med-2025-1374

    Figure Lengend Snippet: The effects of MAP1B and DAPK1 on the membrane blebbing and autophagy of LPS-treated HK-2 cells (A) the membrane blebbing of LPS-treated HK-2 cells in the si-NC+OE-NC, si-DAPK1+OE-NC, si-NC+OE-MAP1B and si-DAPK1+OE-MAP1B groups was observed under the microscope (magnification × 400, scale bar=100 μm). (B) The protein expression of Atg5 and the ratio of LC3II/LC3I in each group were determined by western blot. GAPDH served as the internal control. The data are presented as the mean±standard deviation of three independent experiments; ** p<0.01, *** p<0.001 vs. si-NC+OE-NC; ˆˆ p<0.01, ˆˆˆ p<0.001 vs. si-DAPK1+OE-NC; &&& p<0.001 vs. si-NC+OE-MAP1B; ++ p<0.01, +++ p<0.001 vs si-NC+OE-NC+BafA1; ΔΔ p <0.01, ΔΔΔ p <0.001 vs. si-DAPK1+OE-NC+BafA1; ### p<0.001 vs. si-NC+OE-MAP1B+BafA1; $$$ p<0.001vs. si-DAPK1+OE-MAP1B. Abbreviation: MAP1B, microtubule associated protein 1B; DAPK1, death associated protein kinase 1; LPS, lipopolysaccharides; si-DAPK1, silenced DAPK1; NC, negative control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

    Article Snippet: Renal tubular epithelial cell line HK-2 (AW-CELLS-H0142, Anweisci, China), and RPTEC/TERT1 cells (CRL-4031, ATCC, Virginia, MA, USA) were placed in Minimum Essential Medium (MEM, BC-M-019, Sbjbio, China) enriched with 10 % fetal bovine serum (FBS, FCS500, ExCell, China) at 37 °C with 5 % CO 2 .

    Techniques: Membrane, Microscopy, Expressing, Western Blot, Control, Standard Deviation, Negative Control